Hannah Cole Notebook

From IGEM07

My Construction Files
My Sequencing Files

Two Projects: Myoglobin and H-NOX

Hcole 13:32, 21 June 2007 (EDT) Since my wiki is the only one currently working out of the high schoolers I have volunteered to write up summary of our first week of training so here it goes: On our first day (6/11/07) we went over the basic oligo tutorial and the overview of cloning the Chris made ( to view these follow this link http://www.openwetware.org/wiki/Arking:JCAOligoTutorialHome ) The overview discusses cloning both verbally and pictorially, I found it very helpful in gaining a basic visual understanding of what we will be doing this summer. We worked as a group to complete the tutorial quiz on construction files and designing oligos. We also discussed how PCR works, restriction enzymes inserts etc. and how to use ApE. Next we watched some videos filmed at the undergrad training. They essentially outlined the project that our iGEM team will be working on and the different divisions of work that people would be doing. On 6/12/07 we got into the actual experimental process of cloning. As part of our training we were going to complete as a group a cloning from start to finish. Amin led us through the first process PCR. First we discussed what exactly PCR does then Amin outlined the key components of PCR template, primers, nucleotides, and enzymes. Next we went over the "recipe" of the PCR so how much of each component we needed the concentration of buffers etc. Amin also told us about the proper handling of the materials by showing us where they needed to be stored and the temperatures needed to maintain our components. We also went over the order in which the components need to be added. Our plasmid, template, and primers were given to us by Lane and they are part of his research. So once we put all the components in the tubes we put them in the PCR machine for 2 hours. We went to lunch and then came back to clean our PCR product. We used a DNA recovery kit. The entire process involves adding solution from the kit centrifuging 3 times, ( 2 wet IE with water, and once dry) elution with water, and centrifuging it to "catch" the DNA. The next day ( 6/13/07) was a busy day. We started by digesting our insert and plasmid in the restriction enzymes BglII and XhoI once again we learned the proper volumes of each component of digestion to use once we'd made our solution we incubated it. About 2 hours later we got out our digests and added them to an agarose gel Image:gel1.jpg . We later extracted them from the gel after locating them on the gel. We had to melt our extracted DNA because it was still in gel form. After the gel had melted we began the ligation process when we join our insert and plasmid together. After ligation we checked our ligation product on a gel to see if it had the right number of bp (base pairs). Next we had to get our plasmid containing our gene into E. Coli. To get the product through the membrane we heated up the bacteria with the plasmid/insert allowing the plasmid/insert to enter the bacteria. Then we cooled them to make sure the bacterias membrane was no longer penetrable. Then we let them grow on a plate overnight. When we came back on 6/14/07 we had colonies. Next we performed a colony PCR to see if out insert was actually in the bacteria. After placing our PCR product in a gel we discovered that our bacteria might have the insert since the PCR product had the right number of bp. We wanted to send our plasmid/insert in for sequencing so we grew our bacteria in a liquid medium overnight. On 6/15/07 we took our liquid grown bacteria and started mini prep so we could send it in for sequencing. In order to do this we had to remove our plasmid from the bacteria we had to lice them or break the membrane which is essentially what mini prep does. Placed primers on our plasmid that would show the people sequencing it what point to start from and what direction to go. On 6/18/07 we got our sequences back. It took a loooooooooooooooooooong time to sequence check the sequences mostly because our primers were poorly designed which cause a lot of mutations in our final product. Sadly none of the mutations were silent so we did not get the product we wanted. We spent just over half our day trying to sequence our inserts. That afternoon we got started on the Single Internal Restriction Sites tutorial (you can find it in the link I gave you). We sent in our construction files for that to Chris. We also did the oligo tutorial again but this time individually. On 6/20/07 we went over any mistakes we had made in the tutorials. This essentially concluded our training. We did more stuff on 6/20/07 but I'll explain that in my next entry.


Hcole 14:48, 21 June 2007 (EDT)

On to the second half of 6/20/07! We finally got the genes we'll be focusing for the next week or however long it takes us to complete cloning. I will be working with H-NOX. For more info on H-NOX and what it does check out these research papers http://www.jbc.org/cgi/content/full/282/2/897 http://www.chemistry.ucsc.edu/teaching/Chem200A/Fall06/PaperLIst_files/MarlettaNO.pdf The sequence for H-NOX looks like this ATGAAGGGGACAATCGTCGGGACATGGATAAAGACCCTGAGGGACCTTTACGGGAATGATGTGGTTGATGAATCTTTAAAAAGTGTGGGTTGGGAACCAGATAGGGTAAT
TACACCTCTGGAGGATATTGATGACGATGAGGTTAGGAGAATTTTTGCTAAGGTGAGTGAAAAAACTGGTAAAAATGTCAACGAAATATGGAGAGAGGTAGGAAGG
CAGAACATAAAAACTTTCAGCGAATGGTTTCCCTCCTATTTTGCAGGGAGAAGGCTAGTGAATTTTTTAATGATGATGGATGAGGTACACCTACAGCTTACCAAGA
TGATAAAAGGAGCCACTCCTCCAAGGCTTATTGCAAAGCCTGTTGCAAAAGATGCCATTGAAATGGAGTACGTTTCTAAAAGAAAGATGTACGATTACTTTTTAGG
GCTTATAGAGGGTAGTTCTAAATTTTTCAAGGAAGAAATTTCAGTGGAAGAGGTCGAAAGAGGCGAAAAAGATGGCTTTTCAAGGCTAAAAGTCAGGATAAAATTT
AAAAACCCCGTTTTTGAGTATAAGAAAAATTAA
I had to make primers so we could order them that afternoon. I decided to cut with BglII and XhoI so my primers look like this Forward:ctagtAGATCTATGAAGGGGACAATCGTCGG Reverse: cgtgaCTCGAGgaatgGGATCCTTAATTTTTCTTATACTCA The plasmid I will be using will be pBca9145-Bca1144 which looks like this :Image:pcatext.txt I will be cutting with BglII and XhoI as I mentioned before. The insert and primers looks like this: Image:hnoxp.txt The plasmid+insert should look something like this: Image:insplas.txt. Here is my construction file Image:conhnox.txt

Hcole 23:31, 23 June 2007 (EDT)

The lab flooded 6/22/07 so I'm taking this opportunity to update the stuff from 6/21/07. On 6/21/07 I got the template for H-NOX so we started PCR. The template was titled Tt29nglal ( this is what I think it said the writing was really small) First I had to dilute my primer since it was in powder form so I made a solution fo 1mM primer and 9mM water to make a 10X solution. For PCR I used 36mL water (mL = microliters) 10mL buffer I think it was called Phusion I'll have to double check. I mL forward primer 1mL reverse primer 1mL 10 millimolar dNTP's .5mL template .5mL enzyme. I the put it in the centrifuge for a quick mix and then in the PCR machine on the PCR 3 step template setting.

Hcole 17:46, 25 June 2007 (EDT)

Back in the lab today. I got mixed up on the order in which to continue after my PCR. I accidentally did PCR clean up before putting it in a gel. I used the Zymoclean Gel DNA recovery kit. I used 200mL of ADB buffer and my entire PCR product. I centrifuged it for 15 seconds dumped it then repeated this twice but instead of adding PCR product and ADB buffer I just added wash buffer to the column. Then I dry centrifuged it for 90 seconds then I accidentally added 200mL of water when I should have used 90mL causing my PCR to be diluted. I centrifuged after adding water for 90 seconds. Then I put it in a gel. I used 15mL of PCR product and 1.5mL of 10X loading buffer I also put 8mL of marker in a seperate well. This gel didn't really work so I did another one using 20mL of PCR 2mL loading buffer and 8mL marker. This one worked much better!
This is the 20mL gel for H-NOX post PCR.
Enlarge
This is the 20mL gel for H-NOX post PCR.

My PCR product came out around 500-700bp which is what I wanted. After gel testing it I set up for digestion. I used 30mL PCR product 1mL of BglII and 1mL of XhoI and 1mL of DPNI 10mL of buffer number 2 and 57mL of H2O for a total volume of 100mL. I placed it in the 37 degree incubator and should be taking it out in about 15 minutes which would equal a total incubation time of 90 minutes.

Hcole 19:21, 25 June 2007 (EDT)

I did digestion clean up after letting my digestion incubate for 90 minutes. I used 200mL ADB buffer centrifuged for 15 seconds. Used DNA Wash Buffer twice at 15 seconds and dry for 90 seconds. I changed columns and added 10mL H20 and centrifuged for 90 seconds. Then I pipeted it into a smaller tube and began to set up my ligation. I used 4.5mL H20 , 3mL of my PCR product (insert), 1mL of pre-digested and gel extracted 9145 template ( thanks Austin!), 1mL 10X T4 DNA buffer, and .5mL T4 DNA Ligase. I mixed it all together and will be letting it sit 45 minutes or so before transformation. For transformation I added 200mL H20 and 30mL 5X KCM to my competent cells. Then I took 100mL of the cell mix and added it to my ligaton product. Then I put this on ice for 10 minutes heat shocked in water for 90 seconds and iced for 90 seconds. Then I plated it on an Amp plate overnight.

Hcole 11:21, 27 June 2007 (EDT)

I came and checked my plate yesterday and I had colonies so I put the pipettes with bacteria selected from my colonies in LB broth with carb and put them in the 37 degree shaker overnight. Then Chris gave me a vector with myoglobin in it. Chris doesn't know exactly where the myoglobin is but he wants me to find out and make a biobrick out of it. The vector is called PBond Vector W6 APS-Myoglobin His6-tct and we don't have a sequences for it. I took 1mL of the vector and added it to competent cells ( exact volume unknown) along with 50mL H20 and 30mL 5X KCM. I then put it in the 37 degree shaker for about 45 minutes and then I cooled it for 10 mins in ice then I heat shocked it for 90 seconds and cooled it for 90 seconds. Then I plated it on a tct plate. I'm slightly worried that the colonies wont turn out ok because there are so many competent cells and not as much vector.

Hcole 15:40, 27 June 2007 (EDT) All of this morning has been spent doing miniprep on my three plate samples. I followed the guidelines for miniprep posted on the lab wall most of which come from the pamphlet contained in the Qiagen kit http://www1.qiagen.com/literature/handbooks/literature.aspx?id=1000248 I used the microcentrifuge method. After miniprep I began a diagnostic digestion of the plasmid contained in my bacteria. I use 3mL of plasmid, 1mL of NEB 2 buffer, .5 mL of XhoI, .5mL of BglII, and 5 mL of H20 for a total volume of 10mL. I checked my other plate with my Myoglobin vector and I have colonies this afternoon I will grow them in liquid medium.


Hcole 20:37, 27 June 2007 (EDT)

I accidentally cleaned my diagnostic digest when I wasn't supposed. It's ok though I might have lost some DNA but it's still there. I cut all the volumes for clean up by ten so the volume was a lot smaller. I ran it on a gel using 5mL of my digested plasmid and 1mL 5X loading gel. Unfortunately my ladder was pretty much noexistent see picture: Image:badgel.jpg . There are two distinct bands though so I'm sending it in for sequencing about 8mL of each. After this I took some bacteria from my myoglobin plate and added it to 2000mL LB and 2mL Tet 1000X. Then I put it in the 37 degree shaker. An hour later I took it out of the shaker. I took 1000mL and added 1mL of arabinose to one. Then I put both of them back in the shaker they'll stay there overnight.

Hcole 13:28, 28 June 2007 (EDT) My email to Quintara didn't go through so I had to prepare my samples for sequencing again. The volume for my myoglobin bacteria was too low so I remade it with 10 mililiters LB and 5 microliters Tet. I put it in the shaker for over an hour. Then I took it out the shaker and put 5 mililiters in another tube. To this other tube I added 5 microliters Arabinose and 5 microliters Iron Sulfide FeSO4 and placed both tubes back in the shaker to sit overnight. Amin told us the basics about composite parts and operons and that concluded the day.

Hcole 14:06, 29 June 2007 (EDT)

I came in and checked my email and got my sequences from Quintara. I'm really happy with how they came out. H1 and H2 both had my insert but were missing the EcoRI site. The third had all the sites. All three didn't match up after my insert but Amin said that it's normal for that to happen since sequence quality isn't good till you get about 50 or so bp in. I spent most of this morning formatting my wiki especially the sequencing section. Then after lunch I miniprepped my Myoglobin vector and added 2nL 5X Ca056 primer to 8nL of my vector. I used the one without arabinose and Fe. Then I sent it in for sequencing which I should be analyzing if all goes well on Monday. Then after a lengthy talk about what to do for our transformations I put my H3 sample which had the best sequencing result on a plate to grow in lefty strain bacteria with 5X KCM on a Cam/Carb plate. Vinni will be growing up the same promoter RBS and terminator that I will need so John told him to make the plates for those since he'd already started.

Hcole 15:44, 2 July 2007 (EDT)

So I came in this morning and looked at my plate. It's not really the best result. I have tons of bacteria so much that it will be hard to pick one single bacteria. There was also some contamination on my plate though no one is really sure how this got there since I plated everything in a sterile environment. I'm pretty sure I'll be able to grow some up in liquid culture though. Then I checked my Myoglobin sequence that I got back from Quintara. Amin showed me how to search for nucleotide sequences within my plasmid on BLAST. We got a 99% match for Sperm Whale Myoglobin. We were able to find it within my sequencing results but it has 3 internal restriction sites. It's not going to be pretty and it's definately going to be hard. I designed my primers which I will post up here once they've been checked by Amin or Farnaz. After lunch I took two bacteria from my H-NOX sample 3 plate and put them in liquid culture to grow in the incubator overnight.


Hcole 18:04, 2 July 2007 (EDT)

New plan of attack for my Myoglobin. We're going to get it synthesized as well as have me work on it but only remove 2 of the internal restriction sites. I'll be removing BglII and XhoI since I will be cutting with them and I will leave EcoRI in the insert. My primers look like this : Outside Forward cgttaAGATCTATGGTTCTGTCTGAAGGTGAATGG. Outside Reverse: ggtcatCTCGAGgttacGGATCCTCATCCCGAGCCACCCTGGTAACCC BglII Forward: GAAAGCTTCTGAAGACCTGAAAAAACATGGTGTTAC BglII Reverse: GTAACACCATGTTTTTTCAGGTCTTCAGAAGCTTTC XhoI Forward:GCTATGAACAAAGCTCTAGAGCTGTTCCGTAAAGA and XhoI Reverse: TCTTTACGGAACAGCTCTAGAGCTTTGTTCATAGC

Hcole 18:39, 3 July 2007 (EDT)

I minipreped my H-NOX sample 3 bacteria this morning. Then I did a test digest using EcoRI and XhoI. Then I ran this on a gel to make sure it was my plasmid and not contamination. I got a very faint band on one of them. Here is a picture of the gel Image:tdh.jpg. Then I did PCR for my Myoglobin so I three PCR products Outside forward + BglII reverse, BglII forward + XhoI Reverse, XhoI forward + outside reverse labeled 1 2 and 3 respectivly. I ran them on a gel to check that they were the correct size and all of them look around 100 200 bp. Image:myopcr.jpg. However Farnaz is worried that there are two bands not one but she isn't certain if there are 2.

Hcole 15:34, 5 July 2007 (EDT)

Today I reran my PCR products for Myoglobin on a 2% gel. They turned out better than my other attempt. So I gel extracted them. I also started the digestion to create my composite part. I'm digesting my ORF and my Promoter in EcoRI and BglII and my RBS and Terminator in EcoRI and XhoI. After the digestion I ran them on a gel and only the ORF and the RBS worked so I gel extracted those. As for the terminator and the promoter we're trying to see if they'll still work though their bp were waaaaaaay off. I'm going to PCR the components for my myoglobin now. One PCR with 1 2 and 3 one with 1 and 2 and another with 2 and 3.

Hcole 14:38, 6 July 2007 (EDT)

Yesterday's sewing PCR turned out less than stellar. The product was very viscous and hard to pipette. So I redid my PCR and while that was running I aliquoted dNTP's for the rest of the lab. Once PCR was completed I ran some of the product on a gel. The 123 product was perfect! A really bright band in the expected place Image:pcrsewmyo.jpg . The 12 and 23 were almost nonexistent on the gel but they were really small fragments so they might not have shown on the gel. I started the digestion of the 123 PCR sew in BglII and XhoI. I forgot to add dPNI so I had to gel extract my insert. I gel extracted it and cleaned it up and left in the freezer. I will get started on ligation on Monday.


Hcole 15:06, 9 July 2007 (EDT) I started today by setting up the digestion of my terminator or TT for short. I digested it in BglII and EcoRI because those are the enzymes my ORF would bind to. I Ligated my insert to Pbca-9145-bBca1144 and added it to competent cells to grow on a plate. Then I took my terminator gel extracted it and ligated it with my ORD after cleaning both of them since they were in gel form. Then I added them to competent cells and grew them on a plate as well.


Hcole 14:27, 10 July 2007 (EDT)

Pretty much all of yesterdays work ended up worthless except for the TT digest. Nothing grew on both my plates which was extremely disappointing. Amin and I looked over what could have gone wrong. For my H-Nox my notebook says Eco and Bam but on this online one I wrote BglII and XhoI. So in all likelihood the enzymes were wrong making the ligation not work and the cells not grow. For my Myoglobin from looking at my PCR Amin has concluded that I probably didn't do PCR cleanup which caused my digestion not to work. So I digested H-NOX in EcoRI and BamHI and I cleaned up my 123 PCR and digested that in BglII and XhoI. Then I cleaned up both of these using the Zymoclean kit. After that I ran both of them on seperate gels. The bands were EXACTLY where they were supposed to be which was a relief. I gel extracted them and did clean up. Then I set up Myoglobin + Pbca-9145, RBS + Promoter, and ORF + TT ligations that ran for 30 minutes. After ligation I killed the ligase and began transformation. I ended the day by plating them.

Hcole 16:35, 11 July 2007 (EDT)

Today I checked my plates I had colonies! Yay! So my Myoglobin plate had 6 colonies which was dissappointing. My ORF TT plate had a good number of colonies that were spread out nicely. My Promoter RBS plate had tons of little colonies so many that I was next to impossible to pick up just one colony with a pipette tip. I decided to do colony PCR on 8 of my promoter RBS and ORF TT colonies. I put all 6 of my Myoglobin colonies into LB-Amp to grow overnight. Once my PCR was finished I ran them on gels to check that my product was the expected size. I had to run the RBS promoter on a 2% gel but I still wasn't able to see any bands. My ORF-TT looked really good. I put the colonies that worked in LB broth to grow overnight.

Hcole 17:36, 12 July 2007 (EDT)

Today I mini-preped all 9 of my LB tubes which took up a lot of my time. Then I prepared 18 samples to be sent in for sequencing today. I hope all 9 of my forward and 9 of my reverse work out well. So far things have been working out very well with my H-NOX and Myoglobin (knock on wood). I put 4 of my Promoter-RBS's in LB to grow overnight. Amin is doubtful they will be successful but it's worth a shot. Vinni already had a successful Promoter-RBS so I'll just use his. Then I clone saved one of my H-NOX samples from a few weeks ago since I haven't been keeping up with my clone saving. Other than that there is not much else for me to do today since everything hinges on sequencing which can take a day or more.

Hcole 18:51, 13 July 2007 (EDT)

I came in today and started looking over my sequencing results. Once again I'm really pleased with the results. Both my H-NOX and my Myoglobin came out nicely. H-NOX had a small mutation or something in between two of the restriction sites but it can probably be chalked up to a sequencing error. Even if this were not the case the mutation is on the plasmid not my ORF or TT so it wouldn't really matter. My myoglobin still has the EcoRI in it which Chris doesn't like so we're going to quick change it on monday. After sequencing I spent a lot of time trying to plan out what I need to do for both of my projects. Then I digested my Myoglobin ORF and Terminator. It didn't work the first time John thinks it might have been an mixup with enzymes. So I redid the digestion and this one worked much better. I gel extracted it and put it in the freezer.

Hcole 19:00, 16 July 2007 (EDT)

Today was a busy day. I cleaned up my gel extracted ORF and TT. I ligated my Myoglobin ORF to the Terminator and transformed it in Righty strain. However I forgot to kill the ligase so I had to do it over again. Then for my H-NOX composite part I digested my ORF TT in BglII XhoI and my T7 RBS in BamHI and XhoI then I ligated them together. After that I digested the ligation with BamHI and grew it on a plate in regular competent cells.

Hcole 18:41, 17 July 2007 (EDT)

Today I came in and took my plates out of the incubator. My Myoglobin TT had colonies but my H-NOX Comp part only had one measly colony. I religated and digested my H-nox stuff and plated it again. I also grew up my ORF TT in righty just in case thats the problem not the ligation or digestion. Then for my Myoglobin I did a colony PCR. 3 samples look pretty good so I put them in LB to grow up for tomorrow. I also did that with my single H-NOx colony. I got my primers in for my quickchange so I added water to them and put them in the freezer.


Hcole 19:24, 18 July 2007 (EDT)

Today I came in early and minipreped my LB tubes 2 with my Myo ORF and Terminator and one with the single colony from the H-NOX composite part plate. After that I sent them of for sequencing. I'm getting forward and reverse samples with the primers Ca998 and G01001. After that we went to an A's game.....they won......yay. Then when we got back I took a colony off the plate of 4TT that I grew in Righty last night. I put the colony in LB to grow overnight.


Hcole 18:30, 20 July 2007 (EDT)

Today I spent most of my time working on sequencing. My H-NOX composite part came back right which was very shocking. My Myoglobin + TT appeared wrong at first but it turns out the scar for the BglII BamHI area was wrong which caused us to think that a mutation was present. It turns out that my Myo TT samples were fine so once again good sequencing results. After that I started Quickchange on my Myo TT. It's kind of confusing because there are so many steps involved. I didn't know I was supposed to dilute my primers so it might not work. Since my composite part for H-NOX was right I plated it so it could grow in BLR bacteria.

Hcole 16:59, 23 July 2007 (EDT)

Today I came in and checked my plate for H-Nox Composite part on BLR. There were little to no colonies which I now realize must be because I heat shocked for too long. So I replated that. I also digested my quick change in DpNI. After digesting it I plated it in Righty strain bacteria. I also made KCM for the lab since there wasn't any. I caught up on my sequencing section of the wiki today as well. Other than that it's been a pretty uneventful day.

Hcole 16:47, 24 July 2007 (EDT)

So when I came in this morning I found that my H-NOX in BLR only grew one colony again. This time I think I heat shocked it at too high a temperature. So I made yet another plate of H-NOX on BLR this time being very very careful to make sure the heat shock was being done correctly. I also took my H-nox and put it in in DH10 on an amp plate using the streaking method. After that I placed 4 of my myoglobin quick change colonies in LB to grow overngiht. Then I updated my construction files and part registry on the wiki.

Hcole 17:55, 25 July 2007 (EDT) Today I minpreped the Quick Changed myoglobin that I grew up last night. Then I digested them with the restriction enzyme I was trying to remove (EcoRI)and ran them on a gel with my unquick changed myoglobin tt that had been digested in EcoRI as well. It was strange because I got 3 bands for the unquickchanged and they were in the wrong spots too. As for the other 4 samples they only had one band in the expected space. So the gel was promising but inconclusive. I sent them in for sequencing. My H-NOX on BLR had colonies finally. So I took one colony and grew it up in LB Amp alongside BLR in LB. I took half the volume of these tubes and put them into a seperate set to which I added IPTG. Then I placed them in the incubator shaker.

Hcole 13:45, 27 July 2007 (EDT)

Today I came in a checked the tubes with the H-NOX assay no color change which was dissappointing. So we're going to run them on a protein gel but we're going to wait and do that later. So then I got my sequences back and checked them. One was right some of the others were waaaaaaaaaaaaaaaaaaay off. So I took the good sample and digested it along with the promoter RBS in BglII and XhoI and BamHI and XhoI respectively. Then I gel extracted them. The band for my ORF TT was very light but at least it was there. Then I cleaned up the gel extracted pieces and ligated them together. After that I digested the ligation with BamHI and plated it. I later found out that the incubator was double the temperature that it was supposed to be. So my DNA fried.

Hcole 18:09, 28 July 2007 (EDT)

I pretty much redid most of what I did yesterday. I religated and BamHI digested my Myoglobin composite part. Then I plated it. I also cleaned out my liquid culture tubes and updated my sequencing section on the wiki put other than that it was a pretty relaxed day.

Hcole 22:08, 30 July 2007 (EDT)

Today I saw that my plates for Myo comp part had nothing on them. So my digestion must have fried in the beggining step. So I went back redigested my Myo TT and Promoter RBS religated, redigested in BamHI and plated again. I also plated my Myo + TT post quickchange so I would have more of it for later use.

Hcole 16:20, 31 July 2007 (EDT)

So today I took my plates out. My Myo TT after QC grew great but my composite part plate didn't do very well. So I took the Myo TT and put it in LB amp so I can digest a lot of it and gel extract it. Then I talked to Chris about my H-NOX assay he said I should re do it this time try adding some Heme. So I regrew my H-nox comp part in BLR today.


Hcole 21:46, 2 August 2007 (EDT)

Yesterday I: Started my Myo over since it didn't work I started by digesting Myo over again. I also regrew my H-NOX since it didn't work.

Today: Myo didn't work so I started from the digestion for both Myo and Promoter RBS. I got 2 colonies on my H-NOX plate so I took one and grew it in LB with a BLR control I then added IPTG and heme.

Hcole 14:11, 3 August 2007 (EDT)

Today I came in and pelleted my bacteria from my H-NOX assay. There are some definate color differences but Chris thinks I might have mixed up the tubes so I'm redoing the assay. I'm growing the H-NOX in Rosetta since the BLR has been acting funny. My Myoglobin didn't work for the 6 millionth time but Farnaz thinks it might be that I'm not using enough of my construct. So I took my entire BamHI digested ligation product and grew it on DH-10B. Other than that I feel really sick so I'm going to go home.

Hcole 12:56, 7 August 2007 (EDT)

I came in yesterday and took my plates out of the refrigerator. My H-NOX had a lawn because I grew it on an LB plate when I was supposed to grow it on amp. So I replated it on amp. My Myoglobin finally grew. So I put all 15 colonies in LB amp.

Hcole 16:24, 7 August 2007 (EDT)

Today I came in and found that my H-NOX plate grew really well. So I took one colony and placed it in 10nl LB amp. Then I took 2nL of Rosetta and placed it in a tube with 10nL LB. I'm going to grow these overnight for my assay tomorrow. Then I miniprepped all 15 colonies and sent them in for sequencing. I also made some LB amp for the lab.

Hcole 09:55, 9 August 2007 (EDT)

Yesterday I started my assay for H-NOX over again. The results at the end of the day were inconclusive so I left it to grow overnight. Then I plated my myoglobin composite part on Rosetta to start the assay for it. I got my sequencing results and the first one I looked at was a 100% match.

Hcole 17:19, 14 August 2007 (EDT)

Yesterday I talked to Chris and we decided for H-NOX I should go the same route Austin did and put it into a PET vector and biobrick it from there. I ordered oligos so that I can put H-NOX in the PET vector. Then I grew one of my 2 Myoglobin colonies in LB Amp overnight.

Hcole 14:48, 15 August 2007 (EDT) Yesterday I continued on with the rest of my Myoglobin assay which is identical to the one I did for H-NOX. I also miniprepped some of my myoglobin and did a test digest to make sure that it was Myoglobin I had. When I digested it I got 3 bands one uncut one single cut and one that was the correct size of the gene. It looked like this Image:myotd.jpg.

Hcole 15:29, 16 August 2007 (EDT) Yesterday I pelleted the Myoglobin assay. The Myoglobin was slightly darker than the Rosetta. To make sure this is the case for all Myoglobin samples I did the assay again but with 4 tubes of Myo. I got my oligo's and did PCR and digestion but I used the wrong enzymes so I have to redo it.

Hcole 18:18, 17 August 2007 (EDT) Yesterday I took my saturated culture and started the Myglobin assay. I also rePCR'ed and digested my H-NOX it didn't work because I accidentally put it in the same tube as the clean up. So I did PCR digest again and left it overnight. We had our meeting in which I gave a presentation about my project.

Hcole 18:18, 17 August 2007 (EDT)

Today I ran my digests on a gel and neither my vector or my H-NOX worked. I redid it again this morning. The vector worked so I gel extracted it. I remade my forward oligo for H-Nox in the hopes that maybe the PCR will work. I also placed my basic parts in a block in preparation to be sent to MIT. Other than that today is my last official day and I'm :(