Melbourne/Plan:Gas vesicles
From IGEM07
< Melbourne(Redirected from Melb:Plan:Gas vesicles)
Contents |
[edit]
Synopsis
- Get plasmids from Maura Cannon and confirm
- In parrallel:
- Confirm function, using bouyancy test , and electron microscopy.
- Measure gene expression using 2DGE.
- Investigate theory of gas vesicle creation and prospective genes,
- Investigate codon usage in original host (since some low usage codons for Ecoli are present).
- Remove biobrick restriction sites.
- Try to remove each restriction site simultaneously in seperate reactions to confirm approach and primer design for each of 8 sites (4 sites in GvpL of pNL29 and four in the extra genes in pNL26).
- Repeat any failures using varied conditions and primers while progressing 2nd,3rd and fourth mutations. This maintains redundancy and helps ensure removal of all sites from pNL29 after four mutation cycles at the cost of more reactions at each stage.
- Investigate promotors and ribosome binding sites and compare them to the current pNL29 expression plasmid using GFP reporter. Design protein generator, and biobrick parts for library, and preassemble.
- In parrellel:
- Design biobrick site insertion primers for each prospective gene and for the complete pNL26 and pNL29.
- Use these to create pairs of biobrick parts that can be ligated to delete each coding region individually, and also parts for each gene.
- Ligate and confirm phenotype hence identifying unnessary genes and the minimum Gvp set.
- Using this and individual gene constructs make and test minimum size Gvp set.
- Ligate individual parts & minimum set to biobrick expression vector
- Design biobrick site insertion primers for each prospective gene and for the complete pNL26 and pNL29.
- In parrellel:
- Confirm coding region
- Confirm phenotype.
[edit]
Preliminaries
- Usefull links (restriction enzymes)(Software)[<open wetware primer design>] [<more primer design>]
- Sequences:
- Ncbi genebank AF053765 (pNL26 7371bp) (pNL29 6036bp) (original source) (FASTA seq.)
- pBluescriptIIKS+ (stratagene) (sequence) (restriction map) (map) (Manual)
- (no spaces sequence 2961bp)
- HindIII cuts at 719 ,EcoRI cuts at 707 ,PstI cuts at 701 ,Xbal cuts at 677 ,SpeI cuts at 683
- (no spaces sequence HindIII *AGCTT....CTGCA* PSTI 2947bp)
- pNL26 Plasmid with insert: (seq 10318bp) (res map) (digests) (reverse complement)
- pNL26 insert PstI--HindIII:(pNL26 7371bp)
- pNL29 Plasmid with insert: (seq 8983bp) (res map) (digests) (reverse complement)
- pNL29 insert PstI--HindIII:(pNL29 6036bp)
- Frame arrangement for Biobrick protein expression.
- Biobrick expression plasmid system.
- Basic biobrick primers pNL26F,pNL29F,pNLR, GvpAF, GvpBF, GvpUR -> 6 combinations
- design primers
- create registery parts
- pNL26 only genes biobrick pcr primers: GvpA,GvpP,GvpQ -> 6 protein generators.
- pNL29 biobrick primers: GvpB,gvpR,GvpN,GvpF,GvpG,GvpL,GvpS,GvpK,gvpJ,GvpT,GvpU
- design forward and reverse primers for each except gvpUF, GvpBR which will definately not be required.
- create registery parts
- Other investigations
- Codon usage in BM
- Locate putative transcription terminators.
- Locate putative ribosome binding sites.
- Locate putative regulation sequences/ promotors.
- Confirm putative genes.
- Blast search homology of each putative ORF & gene.
- Produce phylogenic maps of Gvps.
[edit]
Steps:
- Recovery of genes: (2 days)
- Recover the plasmid from paper provided into solution.(method)
- Transform E.Coli strain DH5alpha. Screen with Amp 100ug/ml (as per ref.)(electroporation & heatshock)
- pick 3 colonies of each
- Overnight Culture x9(6 above and 3 form agar block provided)
- Miniprep
- Produce glycerol stocks
- Confirm presence in recovered sample using digest.(HindIII)
- ->Established Supply of Plasmid
- Induce translation overnight 37deg with IPTG in 100ml plates (method)(2days)
- Confirm transcription RT-PRC,
- Confirm translation (buoyant phenotype method).
- Confirm translation (Namarski optics (direct interferance contrast microscopy method).
- Removal of four biobrick like restriction sites all in GvpL.
- DNA code Usage in Ecoli K12 from http://www.kazusa.or.jp/codon (result)
- (Quickchange XL Kit)(Primer design program) (Manual)(Primer program output) (hand designed primers ordered)
- EcoRI [GAATTC] in gvpL (2858)is out of frame [GA G][AAT][TC A]-> [E(glutamate),N(asparagine),S(serine)]
- Replace with [GA A][AAT][TC A] Glutamate: from [GAG](K12 usage 18%) to [GAA](K12 usage 40%).
- PstI [CTGCAG] in gvpL x 3 (2522,2900,3005) each is in frame [CTG][CAG]-> [L(leucine),Q(glutamine)]
- Replace with [CTG][CAA] Glutamine: [CAG](K12 usage 29%) to [CAA](K12 usage 15%).
- XbaI [TCTAGA] (not present)
- SpeI [ACTAGT] (not present)
- Insertion of biobrick required restriction sites by PCR primer modification.(method)
- Design of primers: see: http://www.openwetware.org/wiki/Designing_primers
- PREFIX Primer 3cctttctagag5 11 bp adds XbaI
- SUFFIX Primer 3tactagtagcggccgctgcagcctt5 25 bp adds (Spe I-Not I-Pst I)
- In Frame for expression when combined with Lac promotor.
- Primer design
- Plasmid extraction from culture
- PCR with biobrick creation primers
- Restriction XbaI & SpeI
- Gel separation
- Ligation with P48J(J61035) which includes --EcoRI-genotmyacin handle-XbalI-RBS-SpeI-PstI- ampicilian--
- Transform
- Plate/Grow/Miniprep
- Sequence
- Add terminator
- Add promotor
- Confirm dna, rna , protein (as for A)
- Design of primers: see: http://www.openwetware.org/wiki/Designing_primers
[edit]
supplementary material for use in experiments
- pNL26 parts:
- GvpA (DNA sequence) (protein sequence)
- EcoRI restriction site 7089 of (original source)
- coden pair change: Isoleucine T57C: [ATT](K12 usage 30%) to [ATC](K12 usage 25%).(adds EcoRV)
- Primer T57AF 5'-ttagcagaagtgattgatcgaatcctcgacaaagggattg-3'
- Primer T57AR 5'-caatccctttgtcgaggattcgatcaatcacttctgctaa-3'
- GvpA (DNA sequence) (protein sequence)
- GvpP (DNA sequence) (protein sequence)
- PstI restriction site 6389 of (original source)
- coden pair change:Glutamine G441A: [CAG](K12 usage 29%) to [CAA](K12 usage 15%).
- mutation Primer G441AF 5'-aatatgaacgaccagctgcaacgcattgaagagatg-3'
- mutation Primer G441AR 5'-catctcttcaatgcgttgcagctggtcgttcatatt-3'
- GvpP (DNA sequence) (protein sequence)
- GvpQ (DNA sequence) (protein sequence)
- PstI two restriction sites 6136 & 6169 of (original source)
- coden pair change:Glutamine G150A,G183A: [CAG](K12 usage 29%) to [CAA](K12 usage 15%).
- mutation Primer #1 G150AF: 5'-aaaactgaagggaaactgcaagaaaaagcaaatgaagcgtc-3'
- mutation Primer #1 G150AR: 5'-gacgcttcatttgctttttcttgcagtttcccttcagtttt-3'
- mutation Primer #1 G183AF: 5'-atgaagcgtcagaaaaactgcaagaaacaaaagaaaaaaatgccc-3'
- mutation Primer #1 G183AR: 5'-gggcatttttttcttttgtttcttgcagtttttctgacgcttcat-3'
- GvpQ (DNA sequence) (protein sequence)
- mutation primer #2
- ORF1 (DNA sequence) (protein sequence)
