Wet to Dry

From IGEM07

50px-Uog.jpg Back To
Glasgow's
Main Page

This is an introduction for the dry lab into molecular and cellular biology. It will give an idea of the scientific techniques we use to manipulate DNA, and explain some of the words the dry lab may have already come across in their modeling.

Contents

The Basics

1. We are working with bacteria in our project. The membrane controls what is allowed in and out of the cell, and the nuclear material is a scrunched up ball of DNA called a chromosome.

2. This is a human chromosome and it shows in more detail that a chromosome is a long strand of DNA compacted to take up as little space as possible inside a cell.

3. This is what a strand of DNA looks like, and it can be referred to as a double helix. The long blue/green part is called the sugar phosphate backbone and the colored parts in the middle are called bases.

4. This should give you an idea of what we mean by sugar phosphate backbone and bases. The left hand side of the picture shows how sugar phosphate units hold bases in place in DNA. The bases are the yellow shapes and each base corresponds to a letter: A, C, G, or T. These letters stand for the molecules shown on the right hand side of the picture (Uracil is used in RNA to replace Thymine).

5. DNA replication. In DNA the double strand is made when the bases of two strands join to form base pairs. A always pairs with T, and C always pairs with G. When more copies of DNA are being made the double helix strand separates and new bases are brought in to make an identical copy of the original double strand.

6. This picture goes into more detail than the dry lab needs to know, but is being used here to explain DNA polymerase. When DNA replicates the double strand splits and an enzyme called DNA polymerase moves along the strand bringing in new bases to make the single strand a double strand.

7. The DNA polymerase knows where to start because a primer marks the start point. In this picture the primer is shown in green. Primers will be explained in more detail later.

8. Making Proteins. Living things are made up of proteins, loads and loads of different proteins. A protein is a really long molecule made up of smaller molecules which act as building blocks called amino acids. Amino acids in a long chain will react with other amino acids in the same chain causing the long molecule to fold into a shape (quaternary protein structure). A sequence of DNA which makes a full protein is called a gene.

9. There are 20 amino acids altogether, and here they are.

10. DNA is a valuable resource to a cell because it provides the code for making all of the proteins the cell will ever need. For this reason, when a protein is being made the cell uses a sort of back up copy of the code called RNA. In RNA U always pairs with A, because U replaces T. This picture shows how this RNA is made in a process called transcription. An enzyme called RNA polymerase moves along a double strand of DNA, separates it and brings in bases which pair to the single strand. This results in a newly made strand of RNA.

11. After transcription comes translation where the RNA is read and a translated into a protein. The RNA can be separated into codons which are groups of 3 bases. Each codon corresponds to an amino acid.

12. The Table of Codons shows every possible combination of bases in a 3 base codon and which amino acid it translates into.

13. Every cell contains ribosomes. Ribosomes translate RNA into amino acids. In RNA the codon AUG signals to the ribosome to start translation, and UAA, UAG and UGA signal to stop. This picture is slightly more detailed than it needs to be but shows a ribosome reading along RNA and translating it into a string of amino acids.

14. An overall view of transcription and translation. RNA polymerase binds to DNA and transcibes it into RNA. RNA (red) is read by ribosomes and translated into proteins.

15. So how is the RNA polymerase meant to know where on the DNA it has to start transcribing? Several base pairs before the RNA polymerase binding site is a sequence of bases called a promoter. Proteins called transcription factors recognise this promoter sequence and bind to it. This signals to RNA polymerase to come and bind as well so that it can start transcription.

Restriction Enzymes

1. A restriction enzyme is a protein that can cut DNA. There are many different restriction enzymes, and each one recognises a different sequence in DNA which it will then cut. The sequence is the same when it is read 5' to 3' on each strand, as seen in the the picture.

2. Each restriction enzyme leaves its own cutting mark referred to as a sticky end.

3. Two pieces of DNA with the same sticky ends can be glued (ligated) together with an enzyme called ligase.

Example
Say there are two pieces of DNA, A and B. A contains a gene of interest, and B is a plasmid (a plasmid is a complete circle of DNA found in bacteria separate from the chromosome which can be taken out of one cell and put into another). In piece A there is a restriction site before the gene of interest and another after the gene of interest which are both recognised and cut by a restriction enzyme called XbaI. In the plasmid B there is another restriction site recognised and cut by XbaI. The gene of interest can be cut out and pasted into the restriction site of the plasmid.

Primers

1. Primers are short pieces (about 20 nucleotides) of RNA or DNA that bind specifically to their complementary DNA sequence in a certain Tm temperature according to their GC-% content.

2. Primers enable the DNA polymerase enzyme to add free nucleotides to the growing 3’ end of the primer. Every added nucleotide is chosen so that G pairs with C and A with T thus resulting in a new complementary strand.

3. It is possible to introduce specific changes into the DNA sequence by using “mutated” primers that have carefully chosen and changed bases in their sequence. This technique is called Site Directed Mutagenesis and it can be used for getting rid of unwanted restriction sites in the middle of an important gene sequence for example.

4. Primers need to be carefully designed to make sure they bind only to the target sequence and not to each others for example. They are then ordered commercially.

Example
A well designed primer could look like this: 5´CGTCCAGTACGCGATGCTAGAC3´

PCR (Polymerase Chain Reaction)

1. A polymerase chain reaction amplifies a known sequence of the DNA genome with the help of primers and DNA polymerase enzyme.

2. Primers bind to the template DNA on each sides of our gene of interest. DNA polymerase copies the template strand during the extension step of the PCR cycle.

3. The actual PCR program takes place in a thermo cycler that cycles through three different temperatures; separating the DNA strands, annealing the primers and extending the primers.

4. PCR is extremely sensitive and can amplify millions of copies of DNA from just only few follicle cells surrounding a single pulled-out hair for example.

Transformation

1. During the transformation the plasmid DNA is put into the antibiotic-sensitive bacterial cells.

2. To get started bacterial cell wall and plasma membrane has to be made permeable and the chosen DNA plasmid is taken up by the cell during the heat shock.

3. Antibiotic selection makes it easy to see which bacterial cells have taken up the plasmid DNA and thus a resistance gene for an antiobiotic. An antibiotic resistance gene makes the cells able to live in a plate containing antibiotics.

Check out the PowerPoint slides to see pictures!

Media:Lecture from Wetlab to Drylab.ppt