IGEM 2005 Awards
From IGEM
The following awards were given out at the 2005 Jamboree by the Awards Panel
- Princeton
- Best Plasmid Naming Scheme
- Best "Show Must Go On" Moment
- Best Honest Answer
- Best Simulation of a Simulation
- Oklahoma
- Best "Hail Mary" Cloning
- Best "Quantitative" Answer
- Feynman's Teaching Award
- ETH
- Best Wiki Award
- Most Sensitive Super Model Award
- Precision Engineering Award
- George W. Bush Geography Award
- MIT
- Most Modest Goal
- Least Transportable Visual Aid
- Best Analogy
- Second Most Parts Award
- IKEA Idea Award
- Caltech
- Best Use of Transmogrified Smiley Faces
- Best New Application Area
- Best New New Foundational Research Area
- Chuck D.'s Choice Award
- Toronto
- Best Project Name (Cell-See-Us)
- Most Direct Use of Logic
- Best Advice
- Nothing-Will-Stop-Us Award
- Cambridge
- Most Effective Approach
- Best Master of Ceremonies
- Marshall Cultural Exchange Award
- Best Data & Data Visuals
- Best Uniforms
- Texas
- Best Confession / Negative Control (One Year Late)
- Best Live Demo, Again
- Best Model-Driven Design
- Best Proposed Funding Mechanism
- Penn State
- Best Brick Award (BBa_S03271, MotB)
- Best New Sport (Beijing 2008 or bust!)
- Best Use of Metaphor
- Berkeley
- Red-Eye Award
- XXXtreme Presentation
- Best Conceptual Advance
- Most Innovative Brick Award (BBa_J01002)
- Davidson
- Best Team Name (SynthAces)
- Best Debuggers
- Best Interface Logic
- Harvard
- Best Part Numbers
- Most Organized Presentation
- Best Technology Integration Award
- Most Parts Award
- Best TAATACGACTCACTATAGGGAGA Award
- Best Use of Redundancy
- UCSF
- Coolest Part
- Most Innovative Abuse of Expensive Laboratory Equipment
- Best Device Award
- Most Thoughtful Approach
[edit]
Highlights (some of the things that worked)
- Cambridge - Chemical control of bacterial chemotaxis using BioBrick parts, writing DNA to store information (flipase switch)
- Texas - Working and improved bacterial photography and signal processing device (built from BioBricks)
- Berkeley - Two-way cell-cell DNA communication (could lead to a bacterial internet)
- MIT - Iron-induced control of any BioBrick device
- Penn State - Genetic control of bacterial chemotaxis using BioBricks (MotB)
- Harvard - Write and erase components for a bacterial sketch pad; stamped bacterial patterns to make "biowires."
- UCSF - Wanted biological temperature detector, got a programmable biological thermometer
